Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13602G3
Clone ID IST13602G3
Vector VICTR74
Project tigm

Sequence tag IST13602G3HMR1
Sequence
GGGGTGAGGTCTTCTCTGCCCCCATGCACCCCGTGCTCGTAGGCAGGGTCGATTCTTTCTTTGGGGAGTACTTTCTTGGG
GAGTGAGGCCTCGTGGCTGTGCCCCAGGGAGTTTGGAGCCNAGAGTCTCTGGAAGCACAAAGTAAGGGAGCCTTGTCCCA
GTCCTTGCAGCCTTGTGAGGAGAGCCCGCCTGTTCTTGGCAAGTTGTGGGCGAGGGGTCTGGGACCTAGCCCCCAGGAGC
TTGAGATCATAAAGAAGTACAGGCCTACCCACCAGAGAGCCTGGTTTGGGGGAATTTGGTCTTGCCCGTGTTAGAAACTC
GTGGATGTATTTAGAAAGGGGTCTAAGGACTCGATAATTCTTGGCCCCAGCCTTGANNCGCTGGGGTGAGGANCANNGN
Sequence Type genomic DNA
Unitrap ID UNI17981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41659922..41660316 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036114 (2810432D09Rik) NM_027278 RIKEN cDNA 2810432D09 gene Gene [Source:MGI Symbol;Acc:MGI:1917211]

 
Come back to gene ENSMUSG00000036114


For any suggestions or comments, please send an email to unitrap@crg.es