Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W064E06
Clone ID W064E06
Vector pT1betageo
Project ggtc

Sequence tag W064E06
Sequence
CGGCCTCAACCTCCCAATTTGGGGGATCCGGTTGAACATTTATCAGAGACATCTGGTGACTCTTTGGAAGCCATGTCCGA
GGGAGAAGTACCGAGTCCTTTCGCCAGAGGCAGTCGTACTCGCGCGAGCCTTCCCGTGGTGAGGTCGGCCAATCAAACAA
AGGAAAGATCCCTGG
Sequence Type mRNA
Unitrap ID UNI1514

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20583552..20583723 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es