Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14274E9
Clone ID IST14274E9
Vector VICTR74
Project tigm

Sequence tag IST14274E9HMR1
Sequence
CTACTAAATACAGTTNACACTGTACATGAGCAAGTGTGCGTGGGACAGACGTACATAGGTTCTGGAGACTCCGTGGAGTG
CTGAACCTGTACCGATTTCCGATCTGTTTCTGTTCCTGAAGGCTCTTCTTTAATTACTTTGAGTACCCAAGCCTCGAAAC
GTCCCTACGCTTTCTATGAGTGAGCTCTCTTGCCCGCAAACAGTCTCTGCTTTCTGACGGGTGAAANTCC
Sequence Type genomic DNA
Unitrap ID UNI12968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23729880..23730108 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]


Sequence tag IST14274E9BBF1
Sequence
GTAGGGGAAGTAAGGCGTGGAGAGTTCCGTGATGGAGACTTTACCTAGCATGTAGGGAAACCCTGGATTCAAGCCCAGCA
CCTCAAATAAAATTTAAAAAAAAAAAATTAANNCGGTNCNNGGGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23730105..23730230 116
NO GENE  


Sequence tag IST14274E9HMF1
Sequence
GTAGGGGAAGTAAGGCGTGGAGAGTTCCGTGATGGAGACTTTACCTAGCATGTAGGGAAACCCTGGATTCAAGCCCAGCA
CCTCAAATAAAATTTAAAAAAAAAAANTTNANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23730105..23730213 107
NO GENE  

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es