Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13920C2
Clone ID IST13920C2
Vector VICTR74
Project tigm

Sequence tag IST13920C2HMF2
Sequence
ATTTATCTCTTTCATACACCCTCAGTCCCCTCTCCATGACGTCACTTCCTAGTGTACCTCGTTTGACTATCAGCTGCTGT
GGAACTGCTGCCANACCGTTGGCTTTGCTTGTCCTCCTGACCTGTCTCCAGACCCGACCTGGTGTACAGCCCTGCTTCAG
ACAGCCCACGTTCTCCCAGGCTACATTAANATGACTGATATTCNAGGGGANANAANCATGCTCCCTCATATAATGCACAT
ACTTGTACGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTNNGN
Sequence Type genomic DNA
Unitrap ID UNI18577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27177079..27177365 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]


Sequence tag IST13920C2BBF1
Sequence
TCTGAAGGTTTTGGGTTTCTGTTTGTTTGTTTGTCTGTCTGTCTGTCTGTTTGTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140719231..140719287 57
NO GENE  

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es