Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G020B09
Clone ID G020B09
Vector U3CEO
Project ggtc

Sequence tag G020B09
Sequence
CGGGTAAGTGCTAGTGCTGAGCTCCGCTGCTACCTGCACTTTGCCCTGGCCCTGCAATGGCTTCAACCCGTGCCAAGCCC
ACGCTACCTCTGCTCCTGGCCCTGGTCACCGTTGTGATCCCTGGTGAGTCCGAGGTGGGGTCGCTTTGGG
Sequence Type mRNA
Unitrap ID UNI11369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20820429..20820572 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037405 (Icam1) NM_010493 intercellular adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:96392]

 
Come back to gene ENSMUSG00000037405


For any suggestions or comments, please send an email to unitrap@crg.es