Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10079G5
Clone ID IST10079G5
Vector VICTR75
Project tigm

Sequence tag IST10079G5HMF1
Sequence
CCTTTCGCCTCTGGTAATCTCTGGAGTTAGTAGCTATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI31916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 39101728..39101769 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 110964058..110964099 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 85561784..85561825 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059146 (Ntrk3) NM_182809 neurotrophic tyrosine kinase, receptor, type 3 Gene [Source:MGI (curated);Acc:Ntrk3-001]

 
Come back to gene ENSMUSG00000059146


For any suggestions or comments, please send an email to unitrap@crg.es