Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G019C04
Clone ID G019C04
Vector U3CEO
Project ggtc

Sequence tag G019C04
Sequence
GTCGTCGCGCAGCCCGGACTCGAGCGACGGGAGCGCAAGACACAGACACCCGCCGCGCCACGGCGAGCTCTCCAGAGGCG
GGACCGCAGCGCCAAGTGAGAGTCAGCTTGCGAAGGCAGCCCACGCTCACG
Sequence Type mRNA
Unitrap ID UNI11247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26629809..26642752 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es