Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14699G6
Clone ID IST14699G6
Vector VICTR76
Project tigm

Sequence tag IST14699G6HMR1
Sequence
AGTCCNNNTCAGAAACTGCATGAGTGTCACTTGATGAAAGCATGAAATGCAGAGGCTTAAAGCATAGTTCAAAAATGAAT
ATACAGTTATGGGTATTGGTTGATAAAAGTCATGTTTATAAATGTTTGTTGTCTTGTCCACTTGACCACTTGGAGCCAGT
TACCTAATCCTTTATAAAAGATTACTGTTCACTATCCCATTCTTTCCCCAAGTGATGGTTCCCTTGATGTTCTAGAAGCA
CTCCAAAGCTCTCTCTCANGGCCAGTCANAGAGATACAATTANACAACAGATTACACAGACNCCAACATGGAGACNAANG
GCAGACAGAAAGGGAGAGCTATACNANCANCCTTCANGAAGTTACAGATTTAAACTAACTGAACAGACNCNCNGAGGATG
GAAGCACAGGGAACATGANNTANAGAATTCAACTTTGTACTCNCNCNNNNCNNNNTGCCTCTGANGAAAAGGCTTTCATT
TCTTTCCTTAACTCNACACAGATGCNTTATTAACCNCCANTATGTTNAANCNANTCACATATGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14699G6BBF1
Sequence
CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTCTTTCTTATTAC
Sequence Type genomic DNA
Unitrap ID UNI14535 UNI31760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7304872..7304966 95
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110662251..110662345 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074968 (Tmem16c) NP_001075025 anoctamin 3 Gene [Source:MGI (curated);Acc:Tmem16c-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47484873..47484967 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]


Sequence tag IST14699G6HMF2
Sequence
ACNANTGTATCTATGCNNNNNNTTANGTTTNAAAANTTGATNNNNNNAGAAGTCCAAGGAGAATAATGTTAGTTTTTACG
TTGTTCTTTGAAAAGTGTGCTAAACCCTCAAGTTGAGTAAACAGTAGGATCACAGCTTTAAATCATAAATTTCGTCAAGT
TGCCTTAATTCTGGTTGTGAGGTCCAGGAAAATTCCCCATCTATTACAAGGTAAGATGTTTTATATAATACATTGTCACA
CGTATGGTTCTGCCNATGCATANGAAANCNCCNTGGAGCAAGACTCCATGGAGTCCTGCTGGATGTANTCTTAGTAAGAT
GTTCACAAAACANANCNNAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es