Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12755G7
Clone ID IST12755G7
Vector VICTR76
Project tigm

Sequence tag IST12755G7BBF1
Sequence
AGATAACACAGAGCCCGATTAAAATAAATTGGCATTGGAGTGCTTCNCCCTTTAN
Sequence Type genomic DNA
Unitrap ID UNI31920

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59287375..59287428 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108507001..108507054 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]


Sequence tag IST12755G7HMF1
Sequence
NNANAACACAGAGCCCGATTAAAATAAATTGGCATTGGAGTGCTTCACCCTTTANCTATTTGACTTANAATGTAACTTGA
TACTGCCCAGCCACTGAGCCTCAGCGTGTCTGCACTGCCGGGGGCCCTGGGACGGCCCCTGCTTTCCAGCATCATGTTTG
ACTGGAGCCGGAGTCCTGGGGAAGGTGCACGGGTGGCAGANAGTAGGAAACTGAGTTGGCCTGCATAATAGGATGGAGCA
CACAGTTACTTACCTGGCCTTANCTGGNCAGCCAGGGCACAGAGCANAGCAAGGTCGCACTGCAGGCTTGCTTTTANTCT
TGAATGTGAGGTTTTTCNCTAAGTCAGGCCATCCAGACNNGCACCACAGCAGANGTGGGCTACCNCACCTCTGGACTTGG
ANACTGNTTCANCATGGTGCTTCCTTTTGTTTCTTAAAGAAAANAAATCCACCTTTGANAGGAGTTGTTCCCCANATGAN
TTTCTTTTTCCNTGNNTGTTCCTTTTGANCCAGTNNTCNNGTGGTGTACTCTGANCTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es