Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13224D2
Clone ID IST13224D2
Vector VICTR74
Project tigm

Sequence tag IST13224D2HMR1
Sequence
GNGNNAGNGNNCCCTAGCCCAGACTCCATCCTAGGCACGGTNGCCCTGCTCTGCAGGGGGCTCATNGCTTGGANTNTTNC
AGCCTCACNTNTGGCGTGACCTTGGGCCGTTGGGCCTAGACCCGTAGAGATTTTCGCGTTTCCTTCCGAGCCCTGGAAGG
TGTGTTGTTGATTATCCTGAACCTTCACGGAAATGGTCGCGTCCGTTTATTTCTTACAGGCCTTGACGTGTTAATGATCT
CTGGGTTTCCTGTTGGCTAGTCAAGCCATGGTTTAAGCTGTCCACTTCCCTGAAATATGTTAGACCAGGCAGTGTTTTCC
GCCGACGTGAAACTTGGGATATGTCTAGAAAGGGGCCTTCTCTTGATGACTGTGGGTGAAACTTGGCGTGTGTTTTAAGG
AGGCTTTCCCTGGATGAATGTGAAGCAATAGGAACTCTACAGAGCTGTGAGGCGACCACCTGTTTTCCTTTTACCTGTGT
TTGCNACACTAAAATACAGACCACGGGATACTGACNANACACNACTGCGAGACTGTAATCNTCATNNGTACCGAANTNTA
AANTATATN
Sequence Type genomic DNA
Unitrap ID UNI9428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95621780..95622336 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028106 (Rprd2) NM_001081293 Regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]


Sequence tag IST13224D2BBF1
Sequence
GTTCGAGGCCAGCCNCATCTGCACATTGAGTTCCAGANTAGCCNGCCAGAGCAAAATAGTGGGATCTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028106


For any suggestions or comments, please send an email to unitrap@crg.es