Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G014F02
Clone ID G014F02
Vector U3CEO
Project ggtc

Sequence tag G014F02
Sequence
TCCGGTTAAAATCAGAGTCGGAGGGAGGTTTAACCACGAATCGGTCCCGATCGGATTATTCCTTAAAGGGGACGCGCCAT
TGTCAAAGAGAACGGAGCCNNNGGCCCGAGGGCGGGTACCGGCCCCCCTCNNTATNNAGGCAGGGGGTGGGGGTTGGTGT
CCTGCCTTCGACATTCCGCAGTCTGCTATACACATGGACTGACCTTGCTGCTTTTCCCAGCGTGCCCCTCTTCAGTGCCT
GCTCCAGGTTGAACAAGCTTCTAGANNGATCCTTTCCACATGTGGTGTCTTATCTACAAACTCTGTGCCTCAACCTCANN
NNTNTAAAGG
Sequence Type mRNA
Unitrap ID UNI10776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73612158..73647803 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es