Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10308B9
Clone ID IST10308B9
Vector VICTR76
Project tigm

Sequence tag IST10308B9HMF1
Sequence
TTNACGTGGTAAGCTTTCTTATGGTGGTTAGAGGATAATTTGTAGGGCTTGGTTCTCTCTTTCCATCCTCTGTGTTGGGG
TGGGGGTATTTGGTCATCAGGCTTGATGCAAGAACTTTTATCCTCTGAGCCATCTTGCCAGCTCCTTGTTGGAAAATTTA
AAAATTAAATCAAGAGGACAAAAAGCACATTTTGTANCAGTTTCTCCCTNATGTTATGGTGAACATCCCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22432815..22433051 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST10308B9BBF1
Sequence
TTNACGTGGTAAGCTTTCTTATGGTGGTTAGAGGATAATTTGTAGGGCTTGGTTCTCTCTTTCCATCCTCTGTGTTGGGG
TGGGGGTATTTGGTCATCAGGCTTGATGCAAGAACTTTTATCCTCTGAGCCATCTTGCCNGCTCCTTGTTGGAAAATTTA
AAAATTAAATCAAGAGGACAAAAAGCACATTTTGTANCAGTTTCTCCCTCATGTTATGGTGAACATCCCCCCCCCCCANN
ATTTTNTNGN
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22432807..22433051 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es