Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14764B12
Clone ID IST14764B12
Vector VICTR76
Project tigm

Sequence tag IST14764B12HMF1
Sequence
CTGTGATCACCTGCGCTCCTCCTAACAACACAGGCAATAGCCGGTCTGTCCGCATGGCCCTACAGGAGTAGGATTCCTGA
TTCCTCCAGCCGAGAAACTGCAGTGTGCATAATCTGCCTGTGCCTAGGAGGTCCCTCACATCCCCACGTGACTGCTGTGA
CTGACAGCCTTCTGCCCTGCCCCAACATGAATGAGTTCCCTGGCATAGGCCTGCCCAGCCCCTCCCTACAGAATCCCTGG
TTCTGTTCTAGGGAGTGGCCTGCAGGTTGGGCAGACACAAAGTTATTTACCCAGTGACTCTGGAGATTATATATCAAAGC
AACCTGGNTCCCATCTAGAAACAGGGCNNNNTGTGTCTGGGN
Sequence Type genomic DNA
Unitrap ID UNI31924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91121527..91121888 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040591 (1110051M20Rik) NM_175123 RIKEN cDNA 1110051M20 gene Gene [Source:MGI Symbol;Acc:MGI:1915079]

 
Come back to gene ENSMUSG00000040591


For any suggestions or comments, please send an email to unitrap@crg.es