Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11845E4
Clone ID IST11845E4
Vector VICTR76
Project tigm

Sequence tag IST11845E4HMF1
Sequence
AGGTNNANNCCNTNNNNAANNNNTCGCGTCTGGCCNNNNNGNNNNNNNNTTNNNTANGNCTGCGGCCCGCCCAGGCTGCT
GCCTCAGCGGCTCTGTGCTTCTGCCCGTCCCAGAAGCTGTCAGGTTCTCTGGCGCACCCTCTAACCTGTTCAGACTAATT
TCCTAAGTTCTGCTGAGTCCCGGAACCAAGATGGCGACTGCTGCTGCTGAGGCTGAGGCCGCCTCCCAAGCCAGGCGGAC
ACCTGTCCTCTGGTCCGGATGGTGGCCGGTTGTCTA
Sequence Type genomic DNA
Unitrap ID UNI31926 UNI31927 UNI31928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 111610896..111611111 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035694 (Caps2) NM_178278 Ca2+-dependent activator protein for secretion 2 Gene [Source:MGI (curated);Acc:Caps2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 24229191..24229406 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063142 (Kcnma1) NP_034740 potassium large conductance calcium-activated channel, subfamily M, alpha member 1 Gene [Source:MGI Symbol;Acc:MGI:99923]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55227901..55228116 216
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 78351007..78351222 216
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27392590..27392805 216
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 80803262..80803477 216
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 59429920..59430135 216
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7621916..7622131 216
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 68327785..68328000 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078690 (D0Kist4) DNA segment, KIST 4 DNA Segment [Source:MGI Symbol;Acc:MGI:108437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15442727..15442942 216
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 23952075..23952290 216
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 38308453..38308668 216
NO GENE  

 
Come back to gene ENSMUSG00000078690


For any suggestions or comments, please send an email to unitrap@crg.es