Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14566C11
Clone ID IST14566C11
Vector VICTR74
Project tigm

Sequence tag IST14566C11BBF1
Sequence
CTATGTATGCTGCCACAGTCTCTGTGTGTTTCTATGTTTTTAGCCCTGTTGTGTTTGGAAGACACTGTTTTCTGGGTGTG
ATTCATTGCCGAATCATCCCGCCTTTCCTACATAGTTTTCTAAGCGCTGAGGGGAGAGGTTTGATGGATACATGCCATTT
AAGACGAGTGCGAATCAAAGGAAGACATGACCACTCCAAGGTAAGGTTGAGGTTTTTATTGTAGACATGAGGGAGATACA
GTCAGAGGCACCTGGAAGAGTCCAGAACAGGCAGAGAAAGTAGACTGAACACAGCCAGTTAAAGGAGAGAGGGAAGGAGA
ATGAGAGGAAGAAAAAGGAGCAAAGGAGGGCAAAGGCTATTGAAAGTGGACCCAAGANCGCACATGGCCCNNATGTCANG
TTTCCCCCCCTCCN
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448130..100448542 403
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST14566C11HMF1
Sequence
CTANGNANGCTGCCACAGNCNCTGNGNGNNTCTATGNNNNTAGCCCTGNNGTGTTTGGAAGACACTGTTTTCTGGGTGTG
ATTCATTGCCGAATCATCCCGCCTTTCCTACATAGTTTTCTAAGCGCTGAGGGGAGAGGTTTGATGGATACATGCCATTT
AAGACGAGTGCGAATCAAAGGAAGACATGACCACTCCAAGGTAAGGTTGAGGTTTTTATTGTAGACATGAGGGAGATACA
GTCAGAGGCACCTGGAAGAGTCCAGAACAGGCAGAGAAAGTAGACTGAACACAGCCNGTTAAAGGAGAGAGGGAAGGAGA
ATGAGAGGAAGAAAAAGGAGCAAAGGANGGCAAAGGCTATTGAAAGTGGANCCAAGANCGCACATGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14566C11HMR1
Sequence
GGGCCTCCACANNTNNNAGCCNGATGGAGTCCCAGTGCTGAGAGGGGAAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es