Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15097C7
Clone ID IST15097C7
Vector VICTR80
Project tigm

Sequence tag IST15097C7HMR1
Sequence
GCTACCATGGGAACATAAGCCCTCCAGCGGGACAGCCACATGTCACCTGGAAGAAAGCCTAGGTCCTGAGAAGAGAGGCA
AAGTCACTTGCCCCTGGGCCTGCAGCTGCCTTTTGAGAATGCCGGCTTTGAGCCCAGCTTCCTTCTCTTGCCACATTCTT
CAGACACTGAGCACTGTCTGCACTGGGAGCTGACTGTGAAGTGGGGCTAATAAGGCCACAGCCCTTATTAAAGTTTGGAG
GGAAGCGATTAGGAAATGCCCAAATACACAGATAAGAGGGTTTCAGAAGGCTCGAAAAGTTGAAGAAAATAATCGAGCAG
AAGCTCCAGGTGACTGGGGCAATCCGACCTGAGCTAAGGCAGTCAGGGATTATGTGCCGGCCAGCCGGCCGAGGCAGAGC
ACAGTAGCTAGAGAAGATTCATCCTAGTGGGAATGAGCTGGAGGGACCAGTGTATACCTGGAGCGAACTGAGTTGAG
Sequence Type genomic DNA
Unitrap ID UNI31931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35470079..35470555 477
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]


Sequence tag IST15097C7BBF1
Sequence
AGTGAAGCATGCAGAGCCCCTGGGTCAGTCCCCAAAACTGCATAAATGGGTATGGTGGACAGGGACTCACATATACAACC
TCAGTTCTTGAATCAAGAATATTAGGATGTCCAGGTTCCAGACTATGTTGGCTATGTAGTGAGTTCCAGGAGATTTCTAG
ATACATGAGATCCTACATCCAAAAATAAGTAAATAAATAACTAAATGGGGGGGTGTCTCTGGAACATGCTTTATTTTTCC
TTTTTTATTATTTATTGTGACTATAGGTGAAAGTCAAAGAAAAGCTTGTGGGGATTGGTTCTGTCCTTCTACCAAGTAGG
TCCCANGTATTTANTTGCTCANACNTGGTANCNAGTACCCNCTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51967055..51967418 350
NO GENE  


Sequence tag IST15097C7HMF2
Sequence
AGTGAAGCATGCAGAGCCCCTGGGTCAGTCCCCAAAACTGCATAAATGGGTATGGTGGACAGGGACTCACAAACTTCCTT
ATTCTAAAGCACTTAAATAGACCATAAATTTAGTTTTGTCATAATCCTTACATGTATGAATAGGTAGGTTTTGCAATCAG
TTGGCAGAAATATTTTGTTGTTGTTTTATTGCAACCCCAAAATTTAATTAAACATTAAATGCTTAATTGGAATGAAAGCA
AGCTTCTAATTTAATCATATAAAAACTAATTTAAAATAACCCTCCTTGTTTTCCAGGATGTGTTTGGTTCAAGATTAGGT
GTGGTTTTGTGCCTCTGATTTAATCCTGTTTGCCTTGACTTCTGTAANCATTTNAACAATTCTAGGAAAATCTTTANTCC
TGANGAATGGAATTGATTCATGACCCNCGTANTNTATNNNNCANNAACATGGTTTCTCTATTGTTTN
Sequence Type genomic DNA
Unitrap ID UNI33138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 67627765..67628160 366
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033278 (Ptprm) NM_008984 protein tyrosine phosphatase, receptor type, M Gene [Source:MGI Symbol;Acc:MGI:102694]

 
Come back to gene ENSMUSG00000033278


For any suggestions or comments, please send an email to unitrap@crg.es