Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710D6
Clone ID IST14710D6
Vector VICTR76
Project tigm

Sequence tag IST14710D6HMR1
Sequence
ANNNCNGTTTGGAAGTAAAATAAATTTGCAACCCATCCTAAGAAACTGTTTTTCTTTGTGAAGCATGTGAGAAAAGTATT
TTTGGCAAACGTCAGTTTTTTAAAAATAAAGATTTCCAACAAGTGATTCTGGTCATGTANACAAGACCAAAGACATCGTG
CATGAGGCTCGTGAAGCAATAATTCCAGCCTGTGGCCCAAAGCACACTANGAAAAAGTAATTTGGATTTAGGATTTATAA
TAGACTTTGCGGGAAATTCCTCTAAAACACTAATTATGAATCTGTGTATTATGCANCACTGTTTCCCAAGGTGGATTTTA
AAAAAACAATTANAATTGATCTCTGATGGAATATTATATTTACNCGTCNTCATGAANACATCATTTGGCANNAGTTTTGA
ATTANAAAANGANGTTC
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17979942..17980351 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST14710D6HMF1
Sequence
GAGATGACAATGAAATAACCTCTGGAGATAAAGAAATGGTTGGGCTTTTAAGAGAGCCTCCTGTTCTTCCAGAATTCAGT
TCTCAGTACCCTTACTGGGTAACTATCCAGCACCTTCCTCTGGTCTCCAGGCACCCTCACACACATAACATGCACATATA
ATAATAAGATCCCCACCAAAACCAACACTCCCTAAGTAGTAAGTGTAGTTTAAAGAAGAATAAAAGGCAGAACCTCTGGA
GACAGACCCCAGGGGAGACCCCTGGCTCAGGGTGACTCAGCTCCCACAGGCACCGACCAAGAGCTGTGTGGATCCACATG
CCTACTCCTCTGCTGACTTGTCTGTGTCCCTGCATATCCTCGTGGGGGTAATCCTGCAGTTAAGGTTATGTGCTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154563282..154563679 398
 
EST/CDNA Est Name
  AV207189.1 - BU925232.1 - BQ551451.1 - CD551781.1 - BY324044.1 - BY326687.1


Sequence tag IST14710D6BBF1
Sequence
GAGATGACAATGAAATAACCTCTGGAGATAAAGAAATGGTTGGGCTTTTAAGAGAGCCTCCTGTTCTTCCAGAATTCAGT
TCTCAGTACCCTTACTGGGTAACTATCCAGCACCTTCCTCTGGTCTCCAGGCACCCTCACACACATAACATGCACATATA
ATAATAAGATCCCCACCAAAACCAACACTCCCTAAGTAGTAAGTGTAGTTTAAAGAAGAATAAAAGGCAGAACCTCTGGA
GACAGACCCCAGGGGAGACCCCTGGCTCAGGGTGACTCAGCTCCCACAGGCACCGACCAAGAGCTGTGTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154563282..154563595 314
 
EST/CDNA Est Name
  AV207189.1 - BY324044.1 - BY326687.1

 
Come back to gene AV207189.1 - BY324044.1 - BY326687.1


For any suggestions or comments, please send an email to unitrap@crg.es