Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G009D11
Clone ID G009D11
Vector U3CEO
Project ggtc

Sequence tag G009D11
Sequence
TTGAGACCTCTCACCTGTGATGGGCACGACACCTGGGGCAGTTTTTCTCTGACGCTAATTGATGCCCTGGACACCTTGCT
GATTTTGGGGAATACCTCTGAATTCCAAAGAGTAGTGGAGGTTCTTCAGGACAATGTGGACTTTGATATCGACGTGAACG
CCTCTGTGTTCGAAACCAACGTCCGAG
Sequence Type mRNA
Unitrap ID UNI11379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155548168..155554666 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038312 (Edem2) NM_145537 ER degradation enhancer, mannosidase alpha-like 2 Gene [Source:MGI (curated);Acc:Edem2-001]

 
Come back to gene ENSMUSG00000038312


For any suggestions or comments, please send an email to unitrap@crg.es