Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0634
Clone ID CC0634
Vector pGT0lxfT2
Project sanger

Sequence tag CC0634
Sequence
CTTCCATGATGGAAAACACAAAGGATCTGAGTCGGAAGAGACACTAGAAGTCACCCAAAGCAGCCCAGCTTCTGACGAGT
GGGTTTCTGTAAGCCTCCACTCAGAGATGTGATGATCACTGCAATTAAAAA
Sequence Type mRNA
Unitrap ID UNI1517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93747705..93752702 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]

 
Come back to gene ENSMUSG00000059474


For any suggestions or comments, please send an email to unitrap@crg.es