Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14336D9
Clone ID IST14336D9
Vector VICTR74
Project tigm

Sequence tag IST14336D9BBF1
Sequence
AGACATGAGGGGTTCANAGGAGCTGAGGGACAGTGCCAGACAATGCTGGAGGACCATAGCCNCAGCTATTANCAGTTAAA
TCGCCATGAGTAGATTTAGATCACCACCACCCTCCCCTTTCTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGC
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30917302..30917463 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14336D9HMF1
Sequence
AGACATGAGGGGTTCANAGGAGCTGAGGGACAGTGCCNGACAATGCTGGAGGACCATAGCCNCAGCTATTANCAGTTAAA
TCGCCNTGAGTAGATTTAGATCACCACCACCCTCCCCTTTCTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTN
TN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30917305..30917463 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14336D9HMR1
Sequence
GTCTNAACCCAGCCNTGCNAGCTTANNTNCCGGTGGTGGGTCNNNNNNTGTCCTTCCCCAAGTCCCACGCAGCAGTGAGG
ATGAAACCATTCGGGACCTCAAGGCAAGCTGCAGAAGTACCTCCATGAAGCCGCAAATGGGACACAAGTGGGGGGGGAGG
TTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30917509..30917625 117
NO GENE  

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es