Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11089A10
Clone ID IST11089A10
Vector VICTR76
Project tigm

Sequence tag IST11089A10BBF1
Sequence
AGAGTACTCAGAAGAACCCTCCTATTATCCTGATTGGCCTGCCTGGACGCCCTGATTGGCCAGTGATTCTTGAGTGACAT
AAGCATGCTTCTTAGGGTTGGAGTGTGCTGAAGGCACACATTATACACCTTCAGTGCTCAGGATTCTAGTTCAGGAACTT
TGAAAGTAGTGTAGTCACAGCCCANAAAGGGTCAGGACAAAAGGAAGTAGATAACTTCACTGCTTTGACAGTATGTAATA
TTGAGAATGAACAGTGAGGGCTGGCGAGATGGCTCATCAGGTAAGAGCACTAACTGTTCTTCCGAAGGTCCTGAGTTCAA
ATCCCAGAAACCACATGGTGGCTCACAACCACCAGTAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62482120..62482486 363
 
EST/CDNA Est Name
  CD561133.1


Sequence tag IST11089A10HMF2
Sequence
CCATCAGATGACCTGATTCCCAAGGGGCACTGAAAAATGCCTGTTCTTGCGTGTCCAGACCTGCCGGGCTGTGGAGGAGT
CAGTTCGCTTGCTTTGTCATTGAGAACAAACCTGTTTGGAGACTCTTCCACACACAGGGAGTAACAGCCGAGACTA

Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96478455..96478609 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es