Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13600B4
Clone ID IST13600B4
Vector VICTR74
Project tigm

Sequence tag IST13600B4HMR1
Sequence
ACAGTCCTTCCTTCTTGTAGGTGTCTCCAAACAAAGCATACGTGAACGGATTTGGGACTACATGGAATCCCATGATATAG
CTGACTTTCCCCGACCCGTTCATCACAGGATCCCCAACTTCAAGGTACAGAAGTGTCCCTGGCATTGTTAGAAAGGGATT
AGGCTATTTGTGCCAGTGACATAGCTCCACTGCTTTCTGGTGGGACGGATTTGGGGGGCACAGTGTGCGGAGGCANAGTC
CANAGGGCCTGGAGGACACGTGGTGTTTGGACGGGTCCTACTCCCTTACCCCTTAGGCCATGGTCTCTGCACTGTGGCAG
CTCCTGGTGCTTTTCACGGAGCTGGCCTCCCTCAGCCACTTANGGGGGGCTTGTGAANCCCACAGAGGGAAGCCCANCCT
TTANTACCANCCNNGNGCCTCANTGTCCNAC
Sequence Type genomic DNA
Unitrap ID UNI31938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123630466..123630893 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031816 (Mthfsd) NM_172761 methenyltetrahydrofolate synthetase domain containing Gene [Source:MGI Symbol;Acc:MGI:2679252]


Sequence tag IST13600B4HMF1
Sequence
CTGTGACGTACTGCTAAGAAGCAATCCCATAATGCACGTGGGCACATCTATACCTGCCACTGTGACACCACTTGCATAGG
AATTTGCGACCGAGTCAAACCAGCTTAANATAACCAAAAGTATTAGTTTTCCCTCGAGCTCCCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123630890..123631039 146
NO GENE  

 
Come back to gene ENSMUSG00000031816


For any suggestions or comments, please send an email to unitrap@crg.es