Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10157F11
Clone ID IST10157F11
Vector VICTR76
Project tigm

Sequence tag IST10157F11HMF1
Sequence
ATCTCACACTGTAGCCTAAGCTAGCCTGGCATTCTCCTGTGTTGTCCAGGCTTGTGTGTTCAACTTGGGAGCAATTCTTC
TGCCTCAGTTTCTACAGAGCTGGGGTTATTGGCATAGTCATCAAGACACCCAACTTAAGTTTTCTTTCTTGTCTTTTTGT
TGTTGTTGTTAANAGTATTGAAGCCCTCAGGATTTAAAAGTAATTTCTATTTCTGGCCTCTCANAGTGTTTCAAGTCTGC
TGANGTANTTCCCCTGCCCATAAGGACATGACGTCATTGTATAACTTTNACCCAAGTTAAAAGATAANAAGGAAAAAACC
CCTAAACATCCATCTACATAAACAATGCTTAAATCTTTGATTNNCTAGTTTCNNCATCTGANNTTTAGTGGAATAA
Sequence Type genomic DNA
Unitrap ID UNI29586

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71698352..71698746 371
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]


Sequence tag IST10157F11BBF1
Sequence
ATCTCACACTGTANCCTAAGCTAGCCTGGCATTCTCCTGTGTTGTCCAGGCTTGTGTGTTCAACTTGGGAGCAATTCTTC
TGCCTCAGTTTCTACAGAGCTGGGGTTATTGGCATAGTCATCAAGACACCCAACTTAAGTTTTCTTTCTTGTCTTTTTGT
TGTTGTTGTTAAGAGTATTGAAGCCCTCAGGATTTAAAAGTAATTTCTATTTCTGGCCTCTCAGAGTGTTTCAAGTCTGC
TGANGTANTTCCCCTGCCCATAANGACATGACGTCNTTGTATAACTTTTACCCAAGTTAAAAGATAANAANGAAAAAACC
CCTAAACATCCATCTACATAAACNATGCTTAAATCTTTGANNAGCTAGTTTCCACATCTGANCTTTAGTGGAATATTGCT
TTNAAGAGTTNTTTTGNTTGTGCNGGCTCACCAAGTCAGTTGGCANANNNNAGTAGTTTNGNNNGGGGAAAAAAGANAGG
GANGGATGGAACTGTTAATAACTTTCCCCATCAANTCTTCGCAGCTGGCTGNTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es