Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14271C8
Clone ID IST14271C8
Vector VICTR74
Project tigm

Sequence tag IST14271C8HMR1
Sequence
NTACGTCCTACATTTTGGAATCCACCCTCCATCCTTGATAAAATCTTTAAGCCCCAGTATTCTCCCACTCCACATCTTTC
ATAGCACTTGTGTTTTTTTCTTCCCTGTTAAAGCATCTTTTCTCCCCTTCTCCCTCCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI5022

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82664976..82665116 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078669 (AC113019.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TA34]


Sequence tag IST14271C8BBF1
Sequence
TGANAANCATTACAGAAACCTGCTACTTTCTTAACTATGTTAAATATACNANCNCANAGCCCAGTGTGGTANCATATGTC
TTGATAANCANAGGTATGANGATCTCTATAATTTCAAGGCCANCCTGGTCTACACAATGAGTTCCANACCNNCAAAGGCT
ACATGGTGCAGGGGAANAANAAAGGAGAAAGGANAANGGANAAAGGANAAAGGANAAAGGAGAAAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14271C8HMF1
Sequence
TGAAAAGCATTACAGAAACCTGCTACTTTCTTAACTATGTTAAATATACAAGCACAGAGCCCAGTGTGGTANCATATGTC
TTGATAAGCAGAGGTATGAGGATCTCTATAATTTCAAGGCCAGCCTGGTCTACACAATGAGTTCCAGACAGCAAAGGCTA
CATGGTGCAGGGGAAGAAGAAAGGAGAAAGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82664783..82664975 187
 
EST/CDNA Est Name
  BM941850.1

 
Come back to gene BM941850.1


For any suggestions or comments, please send an email to unitrap@crg.es