Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14458E12
Clone ID IST14458E12
Vector VICTR74
Project tigm

Sequence tag IST14458E12HMF1
Sequence
AAATAAAATAAAATAAAATATAAAAAGGAAAAAAAATTGGAAAAAAATATTACAGAAATCAAACATANGCCCACTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14458E12HMR1
Sequence
AGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGCANACCAGG
Sequence Type genomic DNA
Unitrap ID UNI14335 UNI30748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17224997..17225052 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12856296..12856351 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54348046..54348101 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45300976..45301031 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 39527424..39527479 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 38629521..38629576 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13821507..13821562 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23906801..23906856 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35910439..35910494 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57266691..57266746 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33004317..33004372 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027674 (Pex2) NM_021483 peroxisomal biogenesis factor 5-like Gene [Source:MGI (curated);Acc:Pex2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681390..32681445 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53760456..53760511 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 93997794..93997849 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045095 (Magi1) NM_010367 membrane associated guanylate kinase, WW and PDZ domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1203522]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52788648..52788703 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67408330..67408385 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119810223..119810278 54
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7564228..7564283 54
NO GENE  

 
Come back to gene ENSMUSG00000045095


For any suggestions or comments, please send an email to unitrap@crg.es