Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10978H3
Clone ID IST10978H3
Vector VICTR76
Project tigm

Sequence tag IST10978H3HMR1
Sequence
CACACACACAGNGTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
Sequence Type genomic DNA
Unitrap ID UNI10859 UNI31943 UNI31944

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 331792..331842 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161937: 1424985..1425035 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 42222421..42222471 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 31606921..31606971 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 115508271..115508321 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043945 (Adam6) NM_174885 a disintegrin and metallopeptidase domain 6 Gene [Source:MGI Symbol;Acc:MGI:2676316]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 36799272..36799322 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049336 (Odz2) NM_011856 odd Oz/ten-m homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Odz2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 13899685..13899735 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125988511..125988561 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 63761565..63761615 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 10573337..10573387 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 137335200..137335250 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028766 (Alpl) NM_007431 alkaline phosphatase, liver/bone/kidney Gene [Source:MGI (curated);Acc:Alpl-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 143623173..143623223 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152395943..152395993 49
NO GENE  


Sequence tag IST10978H3HMF1
Sequence
TGTGTGTGTGTGTATACACAAGCATGTGAGTATGTGGAGGACACCGGTTCTCTCCTTCCACAATGTGAGTCCTGAAGATT
GAAAACTCTTCATTCAGGCTTGGTGGCAAATGCCTTTCCCAGCTGGCCCTTCTCTCACCCCCTCCACCTTTCTCTTTTGA
GGCAGGGTCTCTCCCTGTGACCTGGGATCACTGACTAGGCTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 137335247..137335449 203
 
EST/CDNA Est Name
  AW227206.1 - BY340885.1

 
Come back to gene AW227206.1 - BY340885.1


For any suggestions or comments, please send an email to unitrap@crg.es