Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14593E2
Clone ID IST14593E2
Vector VICTR74
Project tigm

Sequence tag IST14593E2HMR1
Sequence
GTATCATTGTGTTGTTTCTTGTCTAGTACCTTCAGTACTGTTGTTTTATTCATTTTGTTAGGTTTTTATTATTTCACATA
AGAAAGCCGAATGAAGCGCCTTTTATTCNCTGCATCTTGATTGGAAGTCATGTCATTGTGATACTTTGGGTGTCATCGTG
AGCAGTTGANCATTTTGAGCATGTTGTGGTTTGTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI20513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18013988..18014186 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST14593E2BBF2
Sequence
CACCCGAAAGGAAACTAATATAGCCNCGGACATCCGTACGGTCTTCATGATCTGAGACAAATCAGGGCAGAAGTCTCAAA
TTTTCTGGGTGCTAGCTCCACGTAGCCGATGTAGTTAGTCCTGAATTACAGGTGGTCCTCACCCTTCATGGTTCTGATGC
ATACAAACCTGAGTTACTCAGGCTTAAAAAACACCCCCATCCCCAACAGCATGGTCCTAGTTCAGTTCCCACACAGTGAG
TATCTACAATATAAGCTCCTCCCCCATCCTGATTGGTGCTTGAGTTTGGCATTTCTGCAATTGGTCTTGCGCATCTGTTC
TTCCTTCAGTTCATACACAACCCGGCACGTGACTCCGGTGACTCCGCTATCTCCTTGTCCCCCAGTAACTCCCCGCCCCC
CAAGANGCTTTATGAAAACAGANAAACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 84522628..84523055 422
 
EST/CDNA Est Name
  BY658777.1


Sequence tag IST14593E2HMF3
Sequence
ATACCNGANNGACAAGAAACATGACACAGCCACAAAAGTGCCCAGCTTACTGCCTTGGGAGAGTTTTCAGGCCGAGGAAC
AAGGAGGAGGAACCCAGACAGGGCCTGTGGTCTCCCCAAGTTGAGGAAATGGAGCTGGGAGTCCAAGGAAGCCAAGGTGG
CTAGAGCTCACAAGGGAGACCAGCACTGAGTAGAGAGCTGGAGAGAGAGAGAGAAATGAAGAAATCTACAAAGGCTCATT
CCAGAACTTTTAGTTGAACACCAAATCAGCACTTACATATGAGGGCTGCCCAAGGCCAGAAGAATCANAGGGAACAAGGT
GCAACGTAACACANAGTGACTGATACATACTCCCAAAAGCCAGANCATCCCATCCGAGGGTAAGAAAACAAACACCAGTA
NGCTGGAAAGATGGCTCGTANGCNATACTAATAACCTGANTTGAATACTCGGGACCCATGTGNAANGACAGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18013517..18013991 451
NO GENE  

 
Come back to gene BY658777.1


For any suggestions or comments, please send an email to unitrap@crg.es