Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12073H1
Clone ID IST12073H1
Vector VICTR76
Project tigm

Sequence tag IST12073H1HMF1
Sequence
CTCCAAAGAGGAAAATGAAATTAAAAGCTAGTGCTTAGGTGGGAGATAGGTTTTCTCTGAGTGTGACTTTCTTGCCTTTA
CACATTAGAGATTTGTTGCTGATTGCTCCCATGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI31948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29119319..29119436 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]


Sequence tag IST12073H1BBF1
Sequence
CTCCAAAGNGGAAAATGAAATTAAAAGCTAGTGCTTANGTGGGAGATAGGTTTTCTCTGAGTGTGACTTTCTTGCCTTTA
CACATTAGAGATTTGTTGCTGATTGCTCCCATGTTAACACTGTACATGACTTTATGGGGCACAGCACAGTTGGGTGTAGT
TGGTTTATATTGGCAGATAATGAAGATGTATCTGAAAACTGGTTCTTACTCATATTTTACGTGTGTGTGTGTGTCTATGT
GTGTTTGTGTGTGTGTACATGCATTCTGTGTGTATGGTGGTGGCTTTGTATCTTTCTGCTTCCNNGGGACATGATGACTT
TATTGATGAAAAAAGATACTCTGACAGAANANGANACTNNNTTTTATATANCANANNCNGTATTANCCATANNCTCNNNT
CNNNANCTGGNANTCATCCNCAGANATATCAAGCCANANAACNTTCTCTTGNNCAGCNANGTNTGTGNNCNCACAGCNCC
NNGCNCAGCGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es