Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M120E05
Clone ID M120E05
Vector ROSAbetageo0
Project ggtc

Sequence tag M120E05
Sequence
AGTACAGAAACTACAAGTAAGAATGCTAGTGAGCTTCCAAATATAATATGGAGTTCCAGTGAAAGTGATTTCTCCGATGA
AGATAAGACACTTCCTGCATTACAGAGAGATGGTAGGCATGGCCCTAGAGCCGACAGGCTTGGTGACAGGACTATCTCAT
GTCCCGAAGACGAAGACATTGAAGATGAATTACAGGTTATTGACTGGGAGGTTAACAGTGACAAAGAAGATCCTGGTGGG
CCTAGTGAGTGTGAAGATGATAAGGGTACCCTGGACATCTCAGATTGTGATTCCTGTGCAAGTCTGACAAGTGATGACAG
GCTATGTGAGCCTTCTGAG
Sequence Type mRNA
Unitrap ID UNI4069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16114920..16119080 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]

 
Come back to gene ENSMUSG00000041974


For any suggestions or comments, please send an email to unitrap@crg.es