Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14390D3
Clone ID IST14390D3
Vector VICTR74
Project tigm

Sequence tag IST14390D3HMR1
Sequence
GCATTACTTACTGCCCGCCTTGTGCTCCCTTGAAATCTGGTCACCTGGANGTGGAAGTGGGCAGTGCTTCCGTGCTTCCG
TGCTTCCGCTTTCNCCCANCTCCTTTTAATCACTATTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109142509..109142633 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]


Sequence tag IST14390D3HMF1
Sequence
TTGCCCTTCTGTTACAGGCTTCATTAGCAGTCAGGAGCTTGAGGCTCCAAGTACCCAAAGGACCAGAGATAGAAATGGAC
TGCATGGGGGCAGGGAGCGCTCAGGTTCCTTCCTGGGAGCTTGAAAGTGAACAACCCCAGGTAGGGCTGAGCACAGGGAG
GGGGAATGTAGGCTGGGTTGAGAGTAGCTTTATCATGTAGATCTCGGCTGGGGACCCTGGGATAGTAAGCAGCTTTTACA
AGCTTCCNCTATATATCATTTGGAAATGGAATTATCTATATAGTAACTAAAGTTGGTGCAAAGATTAAAAATCAAAGTCA
CACATCAACAGCTAGTTNANTATTCAATGGANGCACNCCATGAACACTGTANCNATTGTTTGGTGAAAAATGTTTCCAGT
CTGGCTCTGACNCNNGGCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109142093..109142511 399
 
EST/CDNA Est Name
  BY354194.1


Sequence tag IST14390D3BBF1
Sequence
TTGCCCTTCTGTTACAGGCTTCATTAGCAGTCAGGAGCTTGAGGCTCCAAGTACCCAAAGGACCAGAGATAGAAATGGAC
TGCATGGGGGCAGGGAGCGCTCAGGTTCCTTCCTGGGAGCTTGAAAGTGAACAACCCCAGGTAGGGCTGAGCACAGGGAG
GGGGAATGTAGGCTGGGTTGAGAGTAGCTTTATCATGTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109142309..109142511 203
NO GENE  

 
Come back to gene BY354194.1


For any suggestions or comments, please send an email to unitrap@crg.es