Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14380E4
Clone ID IST14380E4
Vector VICTR74
Project tigm

Sequence tag IST14380E4HMF2
Sequence
GTGATGGGTTACTGAACAATGGAGGGCCCCGCCTGGCTGTNCCCTGNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73169532..73169577 44
NO GENE  


Sequence tag IST14380E4HMR1
Sequence
NCTTCCCATCCCANANCTAAGGTGACTGTCTTGCATTTGTGATGGGGCCCCTAAGGTCAAATATTCCGTTCCTTAGGTCT
TGTTTC
Sequence Type genomic DNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95120100..95120184 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]


Sequence tag IST14380E4BBF1
Sequence
AAGTGACCCCCTACCCCAGCTCTCACACAAACAGAAGTAATTTCTGGGGGAGGCCTTCCCTAACTCAGTTCTGGGGAAGA
CCGGCTCACTCCAGACCTCACAGCGCTTAGAACACCCTGACAGCTGAGGCTGGAAACTCGGATAAGTGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95119948..95120102 155
NO GENE  

 
Come back to gene ENSMUSG00000015714


For any suggestions or comments, please send an email to unitrap@crg.es