Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13726H1
Clone ID IST13726H1
Vector VICTR74
Project tigm

Sequence tag IST13726H1HMF2
Sequence
AAGTAATATGAATGCCCATTGTAAATTTACTAATGCGTTTGCGATTGTACGAGGGATAGTTATATCATGTTAGGCGTATT
TACAACCTTGTTATTGTTTCATGTGAACATGAGATATTATTTGTGTCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI31003 UNI31951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11253598..11253729 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 46793808..46793939 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7982285..7982416 132
 
EST/CDNA Est Name
  AA717325.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18975229..18975360 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6715394..6715525 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8906003..8906134 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 49763569..49763700 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 10485647..10485778 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022504 (Ciita) NM_007575 class II transactivator Gene [Source:MGI Symbol;Acc:MGI:108445]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8529867..8529998 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3059083..3059214 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 40100607..40100738 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 142620689..142620820 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12254092..12254223 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 16811722..16811853 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20335201..20335332 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 41965326..41965457 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5178216..5178347 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 31096866..31096997 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30503698..30503829 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 185327..185458 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 72875..73006 132
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19616848..19616979 132
NO GENE  


Sequence tag IST13726H1BBF1
Sequence
AAGTAATATGAATGCCCATTGTAAATTTACTAATGCGTTTGCGATTGTACGAGGGATAGTTATATCATGTTAGGCGTATT
TACAACCTTGTTATTGTTTCATGTGAACATGAGATATTATTTGTGTCAAGTTGACAAGGGGTGGATTGTAGTGGCTATTC
CTGGTTGTCAACTTGACAATATTTGGAATGAACTACAATTCGGAATTGGAAGGCTCACCAGTGACCCTTATCTGGAGGCT
TGGANATCCTTATCTGGATCTTGGTTTGAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI35179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 54952419..54952693 273
 
EST/CDNA Est Name
  BY015027.1 - BY183611.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60015158..60015432 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45468458..45468732 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 46557651..46557925 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62186117..62186391 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 106365689..106365963 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16878903..16879177 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13093568..13093842 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53892837..53893111 273
 
EST/CDNA Est Name
  BU583481.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 53998870..53999144 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 19960558..19960832 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 62170964..62171238 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036885 (AC114424.10) NM_001081295  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34465872..34466146 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 69759900..69760174 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 59738087..59738361 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11415910..11416184 273
 
EST/CDNA Est Name
  CA533825.1 - AA546950.1 - AI505898.1 - CJ073297.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45000150..45000424 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 49895858..49896132 273
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3269983..3270257 273
NO GENE  

 
Come back to gene CA533825.1 - AA546950.1 - AI505898.1 - CJ073297.1


For any suggestions or comments, please send an email to unitrap@crg.es