Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11055D8
Clone ID IST11055D8
Vector VICTR76
Project tigm

Sequence tag IST11055D8HMF1
Sequence
ATGCTTAGTCAGCACCCANAGCTGGTTACTGCTGACTCAGTGAAGAGTCCAGGGTGCTGACTGCTGACCCAGGAGAGGGG
AGGGCAAAGGGGAGGGCAAAGGGGAGGGCACAGGGCAGGTGCTCAGCCTTATTAGATCTGGCCCGGCTTCCTCTGTTTGG
TTACCTGTGTGGAGGAAGCCATCTTTTGACCAATGTCCCCAAGGTTCTCTTGCCTCCGTCATCAGCCATATTTCTACCAC
ACTTGCCTGTCTCTCGCTCTTGTCCTTCCTATATCTAGGTGTGGTGCTCAGTCTTAANAATTTAGTGCTGGAAACCTANG
AAGTCTTTGTGGAGTTACAATCTTTTCACCTGAAAGGCACATGGGGTGGGGGTGTGGCTCAGCAGCAGAGCACTTGCCTC
GTTTGTGTTAGACCTTGGGGTCCATTCCCAGCCTGANGAANGAAGAAAGTATGTTTAGTGGCCTATAATCCCAGCACCTT
GGANGCTGANGCN

Sequence Type genomic DNA
Unitrap ID UNI17373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79985564..79986055 478
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]


Sequence tag IST11055D8BBF1
Sequence
ATGCTTAGTCAGCACCCAGNGCTGGTTACTGCTGACTCAGTGAAGAGTCCAGGGTGCTGACTGCTGACCCAGGAGAGGGG
AGGGCAAAGGGGAGGGCAAAGGGGAGGGCACAGGGCAGGTGCTCAGCCTTATTAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI17373

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79985564..79985703 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es