Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14925C8
Clone ID IST14925C8
Vector VICTR76
Project tigm

Sequence tag IST14925C8HMR1
Sequence
NTTNGNTNACNTNNNCNNNGCNNTNNNNGNGCACNNNAGCAACTGACTGATAATTAAATAATAGCTAATTTTCTACACTT
ACACATCCAAGCCCACATCCCANAAGGCTGGAGCTGTACATGAATGATGCCTATATGTTAGACACTATCATTTCCATCAT
ATGTCTGANAAAATGTTATGTCTGCATTACCCACCTTTTTGTTTTTGTTTTTGTTTTTTTGTTTTTGGTTTTTTGAGACA
GGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTTATTCTACAGACCAGGCTGGCCTTGAACTCANAAATCCATCTGCC
TCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACTGCCTGGCTATGGAATACCTACTTTTTATTCCTGANAAT
TATTCAGGGCTCTAATTTATTTAGTTCTTGTACATATGGCCTTGGACAAGTTACTTAATTCTTCTCCNGTGTGCAGATGT
TTCTTTGCTNACTGCTTCTTGTTGGTTTGGTTNAAGACCTACCTACACTGTANCCCTTTCNNACTTANACCCNNTANNNA
ATGCN
Sequence Type genomic DNA
Unitrap ID UNI11442

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9029180..9029706 493
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071645 (Tut1) NM_197993 terminal uridylyl transferase 1, U6 snRNA-specific Gene [Source:MGI Symbol;Acc:MGI:1917294]


Sequence tag IST14925C8BBF1
Sequence
AAAGAAGGCTCCTAANTTGCTGGCTTGCCCTAATGAGCAGAGTGCTGGGGGGGGGGGGGGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9029091..9029151 59
NO GENE  

 
Come back to gene ENSMUSG00000071645


For any suggestions or comments, please send an email to unitrap@crg.es