Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14440H3
Clone ID IST14440H3
Vector VICTR74
Project tigm

Sequence tag IST14440H3HMF1
Sequence
ATCTGACCCCCTCTTCTGGAGTGTCTGAGGACAGCTGCAGTGTACTTACATATAATAAATAAATAAAC
Sequence Type genomic DNA
Unitrap ID UNI27303 UNI31956 UNI31957 UNI31958

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79674351..79674417 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 101024920..101024986 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 52657746..52657812 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 91766769..91766835 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59210764..59210830 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028381 (Ugcg) NM_011673 UDP-glucose ceramide glucosyltransferase Gene [Source:MGI (curated);Acc:Ugcg-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110749882..110749948 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007080 (Pole) NM_011132 polymerase (DNA directed), epsilon Gene [Source:MGI (curated);Acc:Pole-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19589010..19589076 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78467675..78467741 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046186 (Cd109) NM_153098 CD109 antigen Gene [Source:MGI Symbol;Acc:MGI:2445221]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34408473..34408539 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]

 
Come back to gene ENSMUSG00000006423


For any suggestions or comments, please send an email to unitrap@crg.es