Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P117G09
Clone ID P117G09
Vector ROSAbetageo0
Project ggtc

Sequence tag P117G09
Sequence
GCGGGGAGTTTGCTCCTTCCGCGCGAGCCTCTGGAGAAGCTACAGCACTTAGGCGCCGCCGCTGCCTCCCGGGGCCTG
Sequence Type mRNA
Unitrap ID UNI3664

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87560811..87560876 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]


SPLK-Sequence tag 5SP117G09
Sequence
CTGCAGCAGGTCTTGCAGCTTCTCATAGACTCGCAGTCGCNCNNCACAGCTACTCAGCGCATTGTGCAGGATGTACCCTT
CTTTTCTTCCGGGGCTCACGGAACAGTGCCGATGTCTGCNNNNCGTGAAGGTCAGAGAGGGAGGGACTACTTCTTGATTC
CCAGTCTCTTTCTGCTGAGAGAGAACATGAATTAAAGGTTTAGGTCTGTGGTTACCATTTCTGGAGTCGAGAAAATGATG
GGCATGTCTGATGTTCAGTGAGTACTTAATCCTGAAACTGTTGAGTGTTGGTATGTTGGTATCTTTCTATTTAACAGCCG
GGAACCTTGAGGGTTAAACAGTGAAAACAAGTCAGCAAGGATCCAGGGTTAAGAAGTCCAGTCATCTCAGATTTTAGTGG
TATGCNNAGAGCAGAATGAGGGTAGATGGGTTGCGGACGTTGGAGTCGCACCATGAGTGTTTTTGTAAGTTGAAAACTTT
TT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es