Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12291G12
Clone ID IST12291G12
Vector VICTR76
Project tigm

Sequence tag IST12291G12BBF1
Sequence
TATTTATTGTAAGTACACTGTAGCTGTCCTCAGACACTCCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31103 UNI31105 UNI14597 UNI6936 UNI31966 UNI31967 UNI8049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6946424..6946482 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 39490531..39490589 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019841 (Rev3l) NM_011264 REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rev3l-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 27748324..27748382 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 86497834..86497892 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 33342947..33343005 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062342 (Serpinb9e) NM_011456 serine (or cysteine) peptidase inhibitor, clade B, member 9e Gene [Source:MGI (curated);Acc:Serpinb9e-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 107372848..107372906 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79724663..79724721 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009585 (Apobec3) NM_030255 apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:1933111]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 58675840..58675898 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56223069..56223127 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002833 (Hdgfrp2) NM_008233 hepatoma-derived growth factor, related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1194492]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6207941..6207999 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006740 (Kif5b) NM_008448 kinesin family member 5B Gene [Source:MGI Symbol;Acc:MGI:1098268]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3588622..3588680 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25048253..25048311 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 60328388..60328446 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027763 (Mbnl1) NM_020007 muscleblind-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1928482]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 149653401..149653459 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138212628..138212686 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 101508862..101508920 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87499610..87499668 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109356688..109356746 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041949 (Tmco7) NM_173037 transmembrane and coiled-coil domains 7 Gene [Source:MGI Symbol;Acc:MGI:2142786]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15015751..15015809 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 64438..64496 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 44845..44903 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20915604..20915662 59
NO GENE  


Sequence tag IST12291G12HMF2
Sequence
TATTTATTGTAAGTACACTGTAGCTGTCCTCAGACACTCCAGAAGAGGGAGTCAGATCTCGTTACGGATGGTTATGAGCC
ACCATGTGGTTGCTGGGACTTGAACTCCTGACCTTCAGAAGAGCAGTCAGGTGCTCCTACCCACTGAGCCATCTCACCAG
CCCCCTGTCTCCTGATTTTTGGTTGTTATTATATTGTGGAATTTTATTGTGATGGTGGTGGTAGTTTGGCTGTGTTGTTG
TTGTTGCTGTTCTTTACATTCTTGTCTCCCTCTCCCACCCTCCCCCACCCCAGCCCCGACAGGATTTTACTATGAAGCCC
TGGCTAGCCTGGCACTCACTATATAGTTCAAGTAGGACTCGACCTTGGCATAATCTTCTTGTTTCTGCTCCTTAAAGACT
ATAGTTACAGGCTTGGGCTTTCCCTGTCTATTTGGGGGGACCCTCGCCTGCANGGTCNGGGAANGACTTGATGANTTCNN
GTTCNANAAATCCTGANACATTANATTGCCCATGTGACGTTAGGAATTTCTCTAACAGTATATANTGTGGTGGGCCTGGN
Sequence Type genomic DNA
Unitrap ID UNI14597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79724663..79725221 537
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009585 (Apobec3) NM_030255 apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:1933111]

 
Come back to gene ENSMUSG00000009585


For any suggestions or comments, please send an email to unitrap@crg.es