Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14931A11
Clone ID IST14931A11
Vector VICTR76
Project tigm

Sequence tag IST14931A11HMR1
Sequence
GCCCGAAATCNAAAGTTAGTAGGCCCAATCTTGTGCAAGTCTCTTGAGGGTAAATTTGGCTGCAGAGGGCAACAGCCATG
TCATACCCAGAAGACAGCATTCCACAACACACACACACACACACACACACACACACACACACACACACACACACN
Sequence Type genomic DNA
Unitrap ID UNI31666

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33737606..33737759 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]


Sequence tag IST14931A11BBF1
Sequence
GGGCGAGGGACTCATGTGGCCCTGTCTTTCCTTGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33737569..33737609 41
NO GENE  

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es