Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15033H11
Clone ID IST15033H11
Vector VICTR78
Project tigm

Sequence tag IST15033H11BBF1
Sequence
AGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAGA
Sequence Type genomic DNA
Unitrap ID UNI486 UNI31972 UNI31973 UNI31974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 21673427..21673496 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028033 (Kcnq5) NM_023872 potassium voltage-gated channel, subfamily Q, member 5 Gene [Source:MGI (curated);Acc:Kcnq5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6028158..6028227 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72564386..72564455 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100512668..100512737 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023031 (Ela1) NM_033612 elastase 1, pancreatic Gene [Source:MGI Symbol;Acc:MGI:95314]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35246536..35246605 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147515495..147515564 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029003 (Mad2l2) NM_027985 MAD2 mitotic arrest deficient-like 2 (yeast) Gene [Source:MGI (curated);Acc:Mad2l2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55986718..55986787 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 82277477..82277546 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 80776124..80776193 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 69009762..69009831 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 84102603..84102672 70
NO GENE  


Sequence tag IST15033H11HMF2
Sequence
AAAGGTTTTGGTCTCCGCANCTGGGAGCATGGTGCTGGCTTTACTGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86711231..86711277 45
NO GENE  

 
Come back to gene ENSMUSG00000029003


For any suggestions or comments, please send an email to unitrap@crg.es