Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11711G9
Clone ID IST11711G9
Vector VICTR76
Project tigm

Sequence tag IST11711G9HMR1
Sequence
CTGGGATCCGAACTCCCATACTCCAGTCCTCAGGCTGGATGCTGAGTGCCTTATCCACAGACTCATCTCCGCACTCCTGT
AAAGTTTTATCTGCAGAAGGCATTCTCACTTCCTTTAGAATGTTCGGGCACCTTATCCTGGTTCCAAACCAAAGCCTGGG
GGCATTGCCTGTCAGGCGGAGGCAGTGGTGGAAGAACTGGTTTATGTTTTTCCTGGGAGAATCATAAAGCATGTGATGTG
GTTGTN
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57288670..57288914 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST11711G9HMF1
Sequence
CCAGCACCTACATAAAAACCAGGCAACATAAACCGGGCGTGGTGGCACATGCCTTTCATCCCAGCACTTGGGAGGCAGAG
CCAGCCTCTGAGATTTCTGAGTTTGAGGCTAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAGANAAA
CCCTGTCTCGAAAAACCAAAAACCAAAAACCAAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57288911..57289126 212
 
EST/CDNA Est Name
  BY349020.1 - BY352340.1 - BY347642.1

 
Come back to gene BY349020.1 - BY352340.1 - BY347642.1


For any suggestions or comments, please send an email to unitrap@crg.es