Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M121B03
Clone ID M121B03
Vector ROSAbetageo+2
Project ggtc

Sequence tag M121B03
Sequence
GAGAGGACCCAACTAGTGTAGCTATCGCCAGCATCCAGTCAGCTGCCACTTTTCCTGACCCCAACGTCAAGTAC
Sequence Type mRNA
Unitrap ID UNI11415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173345861..173345934 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es