Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14616A5
Clone ID IST14616A5
Vector VICTR74
Project tigm

Sequence tag IST14616A5HMR1
Sequence
GTCTGTCTTGGCCGTCACTGGCTTTGGGGATACTACTACGACTACCAGAGCGCANTGCGGCAGTGGCGCCTTCTTTGTGT
GTGGGTTGAGACCCTGTTCCATCTANGGAAAGTGCTGCNGGACACCTCTGTTCCCTCANCCACATCTGACCCTANCGCGG
CGGAATTGACACCTTTACTCACATTCTCTTGTGGCTGGGTCTCCACACCTAACTGTCCTTTGGCATTTGAAAAAGGAGTC
GGGCCCCGTTCTAGGCACGTGTCTCCCACCTTTCTGTCTGGGGTAAATGGCATGCGTTANGAGAGTTCCGTGATGCCCTC
CCTCCGTGGTGCAAGCGCTGGCCTACATTGTGCAATGAATGGCTTGGCTTTGTNNNGNNNCN
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102825107..102825479 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]


Sequence tag IST14616A5HMF1
Sequence
AGACAAGGTCCCGAAAAAAANAACAGGCCCTTCTCCCCGGCCTCTTCCAGCTGCACACAAAGGACCGCGCCACCACCCCC
TCACCCCTCCCGCCGGGACTTGTAGTTCCCTTTCCCCCGCCAAGCCGCANAGGGGGAAGAGGACGGACTACAGCTCCCGG
CAGCCTTCGCGCCCGAGCCCCGCACCCTCTGCCTCCATCTTGGCTGCGGTCGGAGTTTCCATTTTCGCTCCCTCCCCCCA
CTTCAGTCACCGACACCGACACCGACACCGCCGCTACCCGCACCCCCTGGCCTCACCTCCTCACTAAGGCTTCGCGGCCG
GCCCTGAGGCCGAGACGGTTGAAGCCAGGGTGAAAAAGGGACGCCTGGAGTAGGAACTCACACTGAACTCTCCTCCATCC
GGAATTCTAGGAGTGCCCACTCTGACACTCAGANGTCCCTCCCNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102824665..102825110 438
 
EST/CDNA Est Name
  BP768376.1 - CV309106.1 - EH111633.1


Sequence tag IST14616A5BBF1
Sequence
AGACAAGGTCCCGAAAAAAAGAACAGGCCCTTCTCCCCGGCCTCTTCCAGCTGCACACAAAGGACCGCGCCACCACCCCC
TCACCCCTCCCGCCGGGACTTGTAGTTCCCTTTCCCCCGCCAAGCCGCAGAGGGGGAAGAGGACGGACTACAGCTCCCGG
CAGCCTTCGCGCCCGAGCCCCGCACCCTCTGCCTCCATCTTGGCTGCGGTCGGAGTTTCCATTTTCGCTCCCTCCCCCCA
CTTCAGTCACCGACACCGACACCGACACCGCCGCTACCCGCACCCCCTGGCCTCACCTCCTCACTAAGGCTTCGCGGCCG
GCCCTGAGGCCGAGACGGTTGAAGCCAGGGTGAAAAAGGGACGCCTGGAGTAGGAACTCACACTGAACTCTCCTCCATCC
GGAATTCTAGGAGTGCCCACTCTGACACTCAGAGGTCCCTCCCGTTAACCTGAGTCTCCTCAGCTGTCTTTAACCTGGCT
CGTTGCTACCCCCACTTTAACACTGANGTCGTACTCACCCCAACAGCTNANCGCCCCCTCTCCAGCGCCGCCNTAAGCAG
CACGGCCCNGTACGTAGGANNNAANNNTCGCTTCNCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102824514..102825110 572
 
EST/CDNA Est Name
  BP768376.1 - CV309106.1 - EH111633.1

 
Come back to gene BP768376.1 - CV309106.1 - EH111633.1


For any suggestions or comments, please send an email to unitrap@crg.es