Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10913G6
Clone ID IST10913G6
Vector VICTR76
Project tigm

Sequence tag IST10913G6HMR1
Sequence
ANCGAAATCTGCCTTCCGCCAATTTTGCTTCCTGTACTGAAAGAAGATCAGGGTAGATGCCCCCCACCTTCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI8117

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4959117..4959189 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]


Sequence tag IST10913G6BBF1
Sequence
NNNNTACTNNTTNTCTGGGGNNNCAGTGGCNNGCNNGNGTNANTNNNNGGGTTNCNGGNNGAATCTAANAAATTNNCCCA
CCCCCATTNNNTAAATNAANGANCNGGAATGCTGGCTNACAGGGTGGNTAAAANNNNGGGGGTGCCTACNTGTTATNTTC
AN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000061374


For any suggestions or comments, please send an email to unitrap@crg.es