Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13568A6
Clone ID IST13568A6
Vector VICTR74
Project tigm

Sequence tag IST13568A6HMF1
Sequence
CAGGCTNAGCTCCTCCTTCTGGAAATTTTGAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76363852..76363886 33
NO GENE  


Sequence tag IST13568A6HMR1
Sequence
CCTGTACGAATTTAACTATAAAGATTATGTAGTTGGCGGTTGGGTAGACCCAGGATGGAAACTCGGGTCTTGATTTATGT
CTGTTTTAGTCCTGGGCTTCTGTTTCTGATGCGGGCCAGGAAGGAAAGAGGGTCGAGACTGGATAGTAGAGATCTGTAAT
CTGTTCTCAGCGCTGGGTCCGGAGGGCAAGTGGTGGGCAGGTACATCTCTGTGGCCTTGGGACGTCATTTTCTTGGGGTC
TTCAGGGTAGCCTTGGATTCTTTTCATAGTCCTCTGACTTTGTATAATCGTAGGCCTTTTTGTAGCACGGGTATGTGCGA
GATTGTGCAGATACGTTGTTTTGTGTCTTCAAGCATTTTCAGTTCTGTTTAAGTAGAGACAGGGTTGAGGTTTCCTGGGT
TTTCTTCCTTCCACATTANCCTCTCTCTCTCTCTCTCTCTCTCTN
Sequence Type genomic DNA
Unitrap ID UNI27121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76363412..76363855 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]


Sequence tag IST13568A6BBF1
Sequence
CAGGCTCAGCTCCTCCTTCTGGAAATTTTGAAGTTAACAATGACAGAAACTATTAACAAATTCAGTTAATCGATCCCCTG
GATCGATTGGGGTTAGTATAAGAAATTCAAAAAGTAAAGGTGGGCAGTATGAAACANAAAGGATTAAAATGGAANAAAAA
GAAATCACTCCTAAGTCCCAAGTACACTTGAATGCTTGTACTAAAAGAGGAAGCAGGGCCAGACCCCCACATGGTGTGTG
CTTAACTTCACCCCNNCNNCAGCTTGTTCAAGTTTGTCCCTGGTTCTTCCTCTCANAANTAANACTCANACTCAAACATA
TTTACNAATGCCTTGGCCNTGTNNCTNCTGACTANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es