Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M121G08
Clone ID M121G08
Vector ROSAbetageo+2
Project ggtc

Sequence tag M121G08
Sequence
TTTCCTAAACATGGCGGCGCCCTTATGTGTGAAGGTGGAGTTCGGAGGTGGTGCAGAGCTCCTGTTTGATGGGGTAAAAA
AGCATCAAGTCGCCTTGCCTGGGCAGGAGGAACCCT
Sequence Type mRNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29682911..29688282 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es