Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14605D4
Clone ID IST14605D4
Vector VICTR74
Project tigm

Sequence tag IST14605D4BBF1
Sequence
ATAGAAAGCTTACTCCTGCCTGCATCCATTCACATCCTACTGTGAAGGGGAAGAGGGTCTCCTGGGTTTTGTTTCATGAG
CGGTACTGGGAATCAAACCCAGGGTCTCACACAAGCTCCTGGTTCTCTTTTTTTTTTTTTTTTTTTTTNNNAA
Sequence Type genomic DNA
Unitrap ID UNI31167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35354806..35354953 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021798 (Ldb3) NM_001039076 LIM domain binding 3 Gene [Source:MGI Symbol;Acc:MGI:1344412]


Sequence tag IST14605D4HMR1
Sequence
CCGGCTGGCACATGGGCACAGGGTCTTCCANCCTGGTGTCNCAATACATCCTATGGGTACTGTATCCCATGTGCCTACCT
TTCTNACANTATGGCTCTCCATCCTCCATGTGGAANAGGCTGTTCCCAAANGGCTTCTTGCAGGCTGCACANANAAAGCA
NGTGNTGTNCCNNGTCTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021798


For any suggestions or comments, please send an email to unitrap@crg.es