Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14935E12
Clone ID IST14935E12
Vector VICTR76
Project tigm

Sequence tag IST14935E12HMR1
Sequence
GGATTTGAACTCAGGACCTTCAAAAGAGCAGTTAGTGCTCTTACCCACTGAGCCNTCTCGCCAGCCCATGGGCATATATT
TTTGTTAAGGTTTATTTGTATCGTATATGTCAGCACAACATATGTACCTAGTATCCAAGGCCAGAAGAGGACATTTGGGT
CTCCTGGGAGTGGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI31991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 67141042..67141218 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074085 (Snurf) NP_149409 SNRPN upstream reading frame Gene [Source:MGI Symbol;Acc:MGI:1891236]


Sequence tag IST14935E12BBF1
Sequence
ATCCCAGCAACCACATGGTGGCTCACAACCACCCGAAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI1364 UNI10943 UNI33020 UNI33021 UNI33022

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21702407..21702453 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035171 (1110059E24Rik) NM_025423 RIKEN cDNA 1110059E24 gene Gene [Source:MGI Symbol;Acc:MGI:1913456]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77876878..77876924 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047466 (8030462N17Rik) NM_178670 RIKEN cDNA 8030462N17 gene Gene [Source:MGI Symbol;Acc:MGI:2444951]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 21213521..21213567 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005958 (Ephb3) NM_010143 Eph receptor B3 Gene [Source:MGI Symbol;Acc:MGI:104770]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75429681..75429727 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40682486..40682532 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 71413941..71413987 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28299361..28299407 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053198 (Prx) NM_198048 reproductive homeobox 3A Gene [Source:MGI (curated);Acc:Prx-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 135592278..135592324 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 114779445..114779491 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047155 (Cyp4x1) NM_001003947 cytochrome P450, family 4, subfamily x, polypeptide 1 Gene [Source:MGI (curated);Acc:Cyp4x1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95296950..95296996 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61882733..61882779 47
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14932747..14932793 47
NO GENE  

 
Come back to gene ENSMUSG00000047155


For any suggestions or comments, please send an email to unitrap@crg.es