Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M120G09
Clone ID M120G09
Vector ROSAbetageo0
Project ggtc

Sequence tag M120G09
Sequence
CCTAAGCCGGCTTTCTTCCTGTTATTTGTGCTTCGTAAAGCGCGGCTGGGTTCCTGGAGAAGCTGCCTCTTACCTAGATT
CCTGAGAAAACGCGGCCACCCAGTCGACCAGGGCCTAACCTTTTGCTTCCTGGGGCTTCAGAGAGCCTGGGCCCCACTGT
CTGGGAGGAG
Sequence Type mRNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71026546..71026715 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es