Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M119F04
Clone ID M119F04
Vector ROSAbetageo0
Project ggtc

Sequence tag M119F04
Sequence
GCGCGGAGGCTGCGTGCTGGTCAATCGCTGCCGCCCTGCGCCCTGCGGAGCTCCAGAGCTCGAACCCCAGCCCTGGAAAC
CCAG
Sequence Type mRNA
Unitrap ID UNI7354

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103222635..103222718 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]

 
Come back to gene ENSMUSG00000033792


For any suggestions or comments, please send an email to unitrap@crg.es