Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12135F12
Clone ID IST12135F12
Vector VICTR76
Project tigm

Sequence tag IST12135F12BBF1
Sequence
CTGGTTTCACTGGATAAATCCACTTTGAGGAGAATTTGCATTTTAGCCTTGTGACTGTTCGCCTGTACCTTGTCTAATGT
ACAATCACTGTGGGATTTTTGCATCTCCATCTTTCCAGATTCGTGCAATCATTTTTTTTTNNATTTAAATTTTN
Sequence Type genomic DNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72659069..72659221 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]


Sequence tag IST12135F12HMF1
Sequence
CTGGTTTCACTGGATAAATCCACTTTGANGAGAATTTGCATTTTANCCTTGTGACTGTTCGCCTGTACCTTGTCTAATGT
ACAATCACTGTGGGATTNNNGCNNCTNCNTN
Sequence Type genomic DNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72659069..72659165 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es